Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
ADP + 5'-HO-AUCACGCUUpCp
?
-
-
-
r
ATP + (AG)10GGCCC-fluorescein
?
Tequatrovirus T4
-
-
-
?
ATP + (AG)10GGCCC-tetramethylrhodamine
?
Tequatrovirus T4
-
-
-
?
ATP + 2'(3')-ribonucleotides
?
ATP + 3'-carboxyfluorescein-labeled DNA/complementary DNA hybrid
?
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-CACTGTAACTGATCCTGCCGCTATG-3'
?
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-CATAGCGGCAGGATCAGTTACAGTG-3'
?
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-CCTAACCCTTTCTTTCTTTTCAGGGTTAGGGTTAGGGTTAGGG-3'
?
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-CGAGGCTGCACT-BHQ2-3'
ADP + 5'-phospho-CGAGGCTGCACT-BHQ2-3'
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-CTAGAGCTACAATTGCGACCG-3'
ADP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
ATP + 5'-CTGGCGCTTGATGGTATTTTTACCATCAAGCGCCAG-3'
?
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
ATP + 5'-dephospho-GAAAA-RNA
ADP + 5'-phospho-GAAAA-RNA
-
-
-
?
ATP + 5'-dephospho-GC-RNA
ADP + 5'-phospho-GC-RNA
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
ATP + 5'-dsRNA
ADP + 5'-phospho-dsRNA
-
-
-
-
?
ATP + 5'-GGCAACAT
?
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-HO-CCGACCAACGAAGGT
?
-
-
-
r
ATP + 5'-hydroxyl poly(A)
?
ATP + 5'-hydroxyl poly(C)
?
-
-
-
-
?
ATP + 5'-OH DNA
ADP + 5'-phospho-DNA
-
-
-
r
ATP + 5'-OH RNA
ADP + 5'-phospho-RNA
preference for RNA substrates
-
-
r
ATP + d(A20)
ADP + 5'-phospho-d(A20)
-
-
-
-
?
ATP + deoxynucleoside 3'-phosphate
ADP + deoxynucleoside 3',5'-diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + GGGCC(AG)10GGCCC-fluorescein
?
Tequatrovirus T4
-
-
-
?
ATP + GGGCC(AG)10GGCCC-tetramethylrhodamine
?
Tequatrovirus T4
-
-
-
?
ATP + GGGCC(AG)12GGCCC-fluorescein
?
Tequatrovirus T4
-
-
-
?
ATP + GGGCC(AG)8GGCCC-fluorescein
?
Tequatrovirus T4
-
-
-
?
ATP + GGGGC(AG)10GCCCC-fluorescein
?
Tequatrovirus T4
-
-
-
?
ATP + GGGGC(AG)10GCCCC-tetramethylrhodamine
?
Tequatrovirus T4
-
-
-
?
ATP + GGGGG(AG)10CCCCC-fluorescein
?
Tequatrovirus T4
-
-
-
?
ATP + GGGGG(AG)10CCCCC-tetramethylrhodamine
?
Tequatrovirus T4
-
-
-
?
ATP + magnetite microspheres coated with TiO2-DNA complex
?
Tequatrovirus T4
-
-
-
-
?
ATP + nucleoside-3'-monophosphate
ADP + nucleoside-3',5'-diphosphate
ATP + oligo (dT)25
?
-
-
-
-
?
ATP + oligonucleotides
ADP + oligonucleotide 5'-phosphate
Tequatrovirus T4
-
-
-
-
?
ATP + r(A20)
ADP + 5'-phospho-r(A20)
-
-
-
-
?
ATP + swing arm I
ADP + 5'-phospho-swing arm I
Tequatrovirus T4
-
-
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
beta,gamma-imidoadenylyl 5'-triphosphate + 5'-phospho-DNA
beta,gamma-imidoadenylyl 5'-tetraphosphate + 5'-dephospho-DNA
CTP + 5'-CTAGAGCTACAATTGCGACCG-3'
CDP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
CTP + 5'-dephospho-RNA
CDP + 5'-phospho-RNA
dATP + 5'-CTAGAGCTACAATTGCGACCG-3'
dADP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
dATP + 5'-dephospho-DNA
dADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
dATP + 5'-dephospho-RNA
dADP + 5'-phospho-RNA
-
-
-
r
GTP + 5'-CTAGAGCTACAATTGCGACCG-3'
GDP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
-
-
-
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
GTP + 5'-dephospho-RNA
GDP + 5'-phospho-RNA
-
-
-
r
TTP + 5'-dephospho-DNA
TDP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
UTP + 5'-CTAGAGCTACAATTGCGACCG-3'
UDP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
-
-
-
-
?
UTP + 5'-dephospho-DNA
UDP + 5'-phospho-DNA
UTP + 5'-dephospho-RNA
UDP + 5'-phospho-RNA
-
-
-
r
[gamma-S]ATP + 5'-dephospho-RNA
[gamma-S]ADP + 5'-phospho-RNA
-
-
-
?
[gamma-S]ATP + 5'-OH-(ribonucleotide)7
[gamma-S]ADP + 5'-phospho-(ribonucleotide)7
[gamma-S]GTP + 5'-dephospho-RNA
[gamma-S]GDP + 5'-phospho-RNA
additional information
?
-
ATP + 2'(3')-ribonucleotides
?
-
no activity with 2'(3')-AMP and 2'(3')-CMP
-
-
?
ATP + 2'(3')-ribonucleotides
?
-
no activity with (2')-AMP
-
-
?
ATP + 3'-CMP
ADP + pCp
Kostyavirus CJW1
-
-
-
-
?
ATP + 3'-CMP
ADP + pCp
Omegavirus omega
-
-
-
-
?
ATP + 5'-CTAGAGCTACAATTGCGACCG-3'
ADP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
-
-
-
-
?
ATP + 5'-CTAGAGCTACAATTGCGACCG-3'
ADP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
substrate is a synthetic 36-mer 5'-OH DNA oligonucleotide d(CCTGTTCTTATTGGCCTCCTGGCATACCTTTTCCGG)
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
the enzyme makes hydrogen bonds to the ribose 2'-hydroxyls of the 5'-terminal nucleoside, via Gln51, and the penultimate nucleoside, via Gln83
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
the enzyme makes hydrogen bonds to the ribose 2'-hydroxyls of the 5'-terminal nucleoside, via Gln51, and the penultimate nucleoside, via Gln83
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
double stranded DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
double stranded DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
minimal length of the substrate is 7-8 nucleotides, optimal size is more than 18 nucleotides in length
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
no preference for overhanging 5'-ends
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
single stranded DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
single stranded DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
single stranded DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
specific for DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
micrococcal-nuclease-treated calf thymus DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
involved in repair of DNA single strand breaks
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
micrococcal-nuclease-treated calf thymus DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
involved in repair of DNA single strand breaks
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Kostyavirus CJW1
-
37-mer oligodeoxyribonucleotide substrate
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
preference for recessed termini within duplex DNA
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
no preference for overhanging 5'-ends
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
involved in repair of chromosomal DNA strand breaks that arise continously, but at low frequency, and are potentially lethal
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
low activity
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
micrococcal-nuclease-treated calf thymus DNA is not effectively phosphorylated
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Omegavirus omega
-
37-mer oligodeoxyribonucleotide substrate
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
double stranded DNA
-
?, r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
double stranded DNA
UDP, ADP, GDP and CDP support the reverse reaction
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
minimal length of the substrate is 7-8 nucleotides, optimal size is more than 18 nucleotides in length
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
nuclease-treated calf thymus DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
large DNA fragments released by nuclease treatment
-
?, r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
large DNA fragments released by nuclease treatment
UDP, ADP, GDP and CDP support the reverse reaction
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
single stranded DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
single stranded DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
single stranded DNA
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
single stranded DNA
UDP, ADP, GDP and CDP support the reverse reaction
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
native and denatured DNA are substrates for the reverse reaction
reverse reaction is promoted by a variety of other nucleoside diphosphates but not by ATP
?, r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
native and denatured DNA are substrates for the reverse reaction
native and heat denatured DNA serve as substrates for the reverse reaction
?, r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
specific for DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
native and heat denatured DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
native and heat denatured DNA
UDP, ADP, GDP and CDP support the reverse reaction
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
acts both on single- and blunt end double-stranded DNA
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
730493, 737431, 737436, 737441, 737443, 737444, 737575, 737888, 737889, 737890, 760338 -
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
double stranded DNA
-
r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
double stranded DNA
excess ADP will cause the reverse reaction to be favored
?, r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
large DNA fragments released by nuclease treatment
excess ADP will cause the reverse reaction to be favored
?, r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
single stranded DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
single stranded DNA
excess ADP will cause the reverse reaction to be favored
?, r
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
preference for single stranded termini due to the narrow tunnel formation of the active site that can only bind slim molecules
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
micrococcal-nuclease-treated calf thymus DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4
-
micrococcal-nuclease-treated calf thymus DNA
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
Tequatrovirus T4 K10
-
-
-
-
?
ATP + 5'-dephospho-DNA
ADP + 5'-phospho-DNA
-
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
-
-
r
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
no activity
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
low activity
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
phosphorylated at a much lower rate than DNA
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
soluble and ribosomal RNA of Escherichia coli
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
synthetic polynucleotides
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
no activity
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
much more efficient as substrate than DNA
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
no activity
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
much more efficient as substrate than DNA
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
no activity
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
enzyme cannot act on RNA less than 10 bases in length
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
solely RNA-specific
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
5'-HO-tRNA is a very poor substrate
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4
-
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4
-
involved in repair of broken RNA termini
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4
-
involved in repair of broken RNA termini
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
Tequatrovirus T4 K10
-
-
-
-
?
ATP + 5'-dephospho-RNA
ADP + 5'-phospho-RNA
-
-
-
-
?
ATP + 5'-hydroxyl poly(A)
?
-
-
-
-
?
ATP + 5'-hydroxyl poly(A)
?
-
-
-
-
?
ATP + nucleoside-3'-monophosphate
ADP + nucleoside-3',5'-diphosphate
-
no activity with thymidine 3'-monophosphate
-
-
?
ATP + nucleoside-3'-monophosphate
ADP + nucleoside-3',5'-diphosphate
-
-
-
-
?
ATP + nucleoside-3'-monophosphate
ADP + nucleoside-3',5'-diphosphate
-
-
-
-
?
ATP + nucleoside-3'-monophosphate
ADP + nucleoside-3',5'-diphosphate
-
no activity
-
-
?
ATP + nucleoside-3'-monophosphate
ADP + nucleoside-3',5'-diphosphate
Tequatrovirus T4
-
-
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
-
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
low activity with homopolymers such as oligo(dA)24 and oligo(dT)24
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
no activity with poly(A)
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
oligo (dT)25
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
-
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
5'-hydroxyl poly(A)
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
5'-hydroxyl poly(C)
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
low activity with 5'-hydroxyl poly(I)
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
5'-hydroxyl poly(dA), at 6% of 5'-hydroxyl poly(A)
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
5'-hydroxyl poly(A)
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
-
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
(dT)10
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
no activity with low molecular weight oligonucleotides
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
-
oligodeoxynucleotides of chain length above 10-12 residues
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
synthetic ribozyme
-
substrate 5'-OH-(ribonucleotide)7
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
Tequatrovirus T4
-
-
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
Tequatrovirus T4
-
oligo dpT(pT)9
-
-
?
ATP + synthetic oligonucleotide
ADP + oligonucleotide 5'-phosphate
Tequatrovirus T4
-
oligodeoxynucleotides of chain length less than approximately 10-12 residues
-
-
?
beta,gamma-imidoadenylyl 5'-triphosphate + 5'-phospho-DNA
beta,gamma-imidoadenylyl 5'-tetraphosphate + 5'-dephospho-DNA
Tequatrovirus T4
-
ATP analog, inhibitory, competitive against ATP
-
-
ir
beta,gamma-imidoadenylyl 5'-triphosphate + 5'-phospho-DNA
beta,gamma-imidoadenylyl 5'-tetraphosphate + 5'-dephospho-DNA
Tequatrovirus T4
-
is no substrate in the forward reaction but can replace ADP and ATP in the reverse reaction
-
-
ir
CTP + 5'-CTAGAGCTACAATTGCGACCG-3'
CDP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
-
-
-
-
?
CTP + 5'-CTAGAGCTACAATTGCGACCG-3'
CDP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
-
-
-
-
?
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
-
-
-
?
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
-
-
-
?
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
-
-
-
?
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
-
-
-
?
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
-
CTP gives 15% of the activity with ATP
-
?
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
-
-
-
?
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
-
-
-
?
CTP + 5'-dephospho-DNA
CDP + 5'-phospho-DNA
-
UDP, ADP, GDP and CDP support the reverse reaction
-
r
CTP + 5'-dephospho-RNA
CDP + 5'-phospho-RNA
-
-
-
r
CTP + 5'-dephospho-RNA
CDP + 5'-phospho-RNA
-
less effective than ATP
-
?
dATP + 5'-CTAGAGCTACAATTGCGACCG-3'
dADP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
-
-
-
-
?
dATP + 5'-CTAGAGCTACAATTGCGACCG-3'
dADP + 5'-phospho-CTAGAGCTACAATTGCGACCG-3'
-
-
-
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
-
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
-
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
-
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
-
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
GTP gives 15% of the activity with ATP
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
-
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
-
-
?
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
UDP, ADP, GDP and CDP support the reverse reaction
-
r
GTP + 5'-dephospho-DNA
GDP + 5'-phospho-DNA
-
-
-
-
?
UTP + 5'-dephospho-DNA
UDP + 5'-phospho-DNA
-
-
-
?
UTP + 5'-dephospho-DNA
UDP + 5'-phospho-DNA
-
-
-
?
UTP + 5'-dephospho-DNA
UDP + 5'-phospho-DNA
-
-
-
?
UTP + 5'-dephospho-DNA
UDP + 5'-phospho-DNA
-
UDP, ADP, GDP and CDP support the reverse reaction
-
r
UTP + 5'-dephospho-DNA
UDP + 5'-phospho-DNA
Tequatrovirus T4
-
-
-
?
[gamma-S]ATP + 5'-OH-(ribonucleotide)7
[gamma-S]ADP + 5'-phospho-(ribonucleotide)7
synthetic ribozyme
-
best phosphate donor
-
?
[gamma-S]ATP + 5'-OH-(ribonucleotide)7
[gamma-S]ADP + 5'-phospho-(ribonucleotide)7
synthetic ribozyme
-
very low activity with [gamma-S]GTP
-
?
[gamma-S]GTP + 5'-dephospho-RNA
[gamma-S]GDP + 5'-phospho-RNA
-
less effective than ATP
-
?
[gamma-S]GTP + 5'-dephospho-RNA
[gamma-S]GDP + 5'-phospho-RNA
-
-
-
?
additional information
?
-
Pnkp is a bifunctional enzyme: 2,3' cyclic phosphate and 5-OH ends are substrates for healing and sealing by Pnkp and Hen1, The 5' end is phosphorylated by the Pnkp kinase and the 2',3' cyclic phosphate is removed by the Pnkp phosphatase
-
-
?
additional information
?
-
-
Pnkp is a bifunctional enzyme: 2,3' cyclic phosphate and 5-OH ends are substrates for healing and sealing by Pnkp and Hen1, The 5' end is phosphorylated by the Pnkp kinase and the 2',3' cyclic phosphate is removed by the Pnkp phosphatase
-
-
?
additional information
?
-
the alpha and beta phosphates are engaged by a network of hydrogen bonds from Thr23 and the P-loop main-chain amides, the gamma phosphate is anchored by the lid residues Arg120 and Arg123. The P-loop lysine (Lys21) and the catalytic Mg2+ bridge the ATP beta and gamma phosphates
-
-
?
additional information
?
-
-
the alpha and beta phosphates are engaged by a network of hydrogen bonds from Thr23 and the P-loop main-chain amides, the gamma phosphate is anchored by the lid residues Arg120 and Arg123. The P-loop lysine (Lys21) and the catalytic Mg2+ bridge the ATP beta and gamma phosphates
-
-
?
additional information
?
-
-
substrate specificity
-
-
?
additional information
?
-
-
substrate specificity
-
-
?
additional information
?
-
-
no activity with thymidine 3'-monophosphate
-
-
?
additional information
?
-
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
-
no 3'-phosphatase activity
-
-
?
additional information
?
-
the enzyme displays no significant activity on mononucleotides
-
-
?
additional information
?
-
-
the enzyme displays no significant activity on mononucleotides
-
-
?
additional information
?
-
-
-
-
-
?
additional information
?
-
-
substrate specificity
-
-
?
additional information
?
-
-
no activity with adenosine, nucleotides, and 5'-mononucleotides
-
-
?
additional information
?
-
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
-
PALF nuclease activity acts on single-stranded DNA or overhangs of duplex substrates. PALF does not open DNA hairpins. Reduction of PALF in vivo reduces the joining of incompatible DNA ends, PALF can function in concert with other nonhomologous DNA end joining proteins. PALF is able to resect 3 overhanging nucleotides and permit XRCC4-DNA ligase IV to complete the joining process in a manner that is as efficient as Artemis. Role for polynucleotide kinase and aprataxin-like forkhead-associated, PALF, in nonhomologous DNA end joining
-
-
?
additional information
?
-
-
PNKP function is modulated by interaction with the DNA repair scaffold proteins XRCC1 and XRCC4, which is mediated by binding of the PNKP forkhead-associated domain to phosphorylated motifs on XRCC1 and XRCC4, overview. Phosphorylation-independent interaction between PNKP and XRCC1 in human cells, since a non-phosphorylated XRCC1S518A/T519A/T523A triple mutant is also bound
-
-
?
additional information
?
-
-
recombinant Nol9 phosphorylates single-stranded and double-stranded RNA and DNA substrates with high efficiency, mainly pre-60S rRNP particles. Nol9 is able to transfer a phosphate to 5' ends of dsRNAs, but cannot phosphorylate 3' termini
-
-
?
additional information
?
-
-
the enzyme plays a role in tRNA splicing. The ATP-binding and/or hydrolysis capacity of CLP1 is required to enhance pre-tRNA cleavage
-
-
?
additional information
?
-
-
enzyme interacts with XRCC1, a scaffold protein that helps recruit repair enzymes at sites of single-strand breakage
-
-
?
additional information
?
-
prefers double-stranded substrates with recessed 5-termini
-
-
?
additional information
?
-
-
PNKP function is modulated by interaction with the DNA repair scaffold proteins XRCC1 and XRCC4, which is mediated by binding of the PNKP forkhead-associated domain to phosphorylated motifs on XRCC1 and XRCC4, overview
-
-
?
additional information
?
-
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
-
the enzyme also has RNA 2',3-cyclic phosphodiesterase, DNA 3'-phosphatase and RNA 2'- and 3'-phosphomonoesterase activities
-
-
-
additional information
?
-
-
the enzyme also has RNA 2',3-cyclic phosphodiesterase, DNA 3'-phosphatase and RNA 2'- and 3'-phosphomonoesterase activities
-
-
-
additional information
?
-
-
protein Las1 interacts with the Grc3 polynucleotide kinase
-
-
?
additional information
?
-
synthetic ribozyme
-
substrate specificity
-
-
?
additional information
?
-
synthetic ribozyme
-
binding constants of the reaction steps
-
-
?
additional information
?
-
Tequatrovirus T4
-
-
-
-
?
additional information
?
-
Tequatrovirus T4
-
substrate specificity
-
-
?
additional information
?
-
Tequatrovirus T4
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
Tequatrovirus T4
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
Tequatrovirus T4
-
enzyme also has DNA 3'-phosphatase activity
-
-
?
additional information
?
-
Tequatrovirus T4
-
poorly active on recessed termini within duplex DNA
-
-
?
additional information
?
-
Tequatrovirus T4
-
in vivo role is possibly in maintaining DNA or RNA in the 5'-phosphorylated 3'-hydroxylated state which is the substrate for many reactions such as ligation and packaging
-
-
?
additional information
?
-
Tequatrovirus T4
-
the enzyme catalyzes both, the phosphorylation of 5-hydroxyl termini and the hydrolysis of 3-phosphomonoesters and 2,3-cyclic phosphodiesters of polynucleotides
-
-
?
additional information
?
-
Tequatrovirus T4
-
the enzyme catalyzes the phosphorylation of the 5'-hydroxyl terminus and the dephosphorylation of the 3'-phosphate terminus of DNA
-
-
?
additional information
?
-
Tequatrovirus T4
-
the enzyme also has RNA 2'-phosphatase activity that requires Asp165 and Asp167
-
-
?
additional information
?
-
Tequatrovirus T4
-
the enzyme shows low activity with ADP, AMP, UTP, GTP, and CTP
-
-
?
additional information
?
-
Tequatrovirus T4 K10
-
the enzyme catalyzes both, the phosphorylation of 5-hydroxyl termini and the hydrolysis of 3-phosphomonoesters and 2,3-cyclic phosphodiesters of polynucleotides
-
-
?