Any feedback?
Please rate this page
(literature.php)
(0/150)

BRENDA support

Literature summary for 2.7.1.78 extracted from

  • Wang, L.K.; Das, U.; Smith, P.; Shuman, S.
    Structure and mechanism of the polynucleotide kinase component of the bacterial Pnkp-Hen1 RNA repair system (2012), RNA, 18, 2277-2286.
    View publication on PubMedView publication on EuropePMC
Search for more literature for 2.7.1.78

Cloned(Commentary)

Cloned (Comment) Organism
expression of His-tagged wild-type and mutant enzymes in Escherichia coli strain BL21(DE3) Acetivibrio thermocellus

Crystallization (Commentary)

Crystallization (Comment) Organism
kinase domain of enzyme Pnkp bound to ATP-Mg2+ or ADP-Mg2+, by hanging drop vapor diffusion, protein solution containing 0.6 mM kinase, 2 mM ATP, and 10 mM MgCl2 with an equal volume of precipitant solution containing 100 mM HEPES, pH 7.5, 200 mM MgCl2, and 30% PEG 400, 22°C, 2 days, X-ray diffraction structure determination and analysis at 2.1 A resolution Acetivibrio thermocellus

Protein Variants

Protein Variants Comment Organism
D38E site-directed mutagenesis, the mutant shows 6% of wild-type activity Acetivibrio thermocellus
D38N site-directed mutagenesis, inactive mutant Acetivibrio thermocellus
K21Q site-directed mutagenesis, the mutant shows 100fold reduced activity compared to the wild-type enzyme Acetivibrio thermocellus
K21R site-directed mutagenesis, the mutant shows 15fold reduced activity compared to the wild-type enzyme Acetivibrio thermocellus
K95A site-directed mutagenesis, inactive mutant, the phenotype is benign Acetivibrio thermocellus
R41K site-directed mutagenesis, the mutant shows about 65% reduced activity compared to the wild-type enzyme Acetivibrio thermocellus
R41Q site-directed mutagenesis, the mutant shows 100fold reduced activity compared to the wild-type enzyme Acetivibrio thermocellus
S22T site-directed mutagenesis, the mutant shows unaltered activity compared to the wild-type enzyme Acetivibrio thermocellus

Metals/Ions

Metals/Ions Comment Organism Structure
Mg2+ required, the P-loop lysine (Lys21) and the catalytic Mg2+ bridge the ATP beta and gamma phosphates Acetivibrio thermocellus

Natural Substrates/ Products (Substrates)

Natural Substrates Organism Comment (Nat. Sub.) Natural Products Comment (Nat. Pro.) Rev. Reac.
ATP + 5'-dephospho-DNA Acetivibrio thermocellus
-
 ADP + 5'-phospho-DNA
-
 ?
additional information Acetivibrio thermocellus Pnkp is a bifunctional enzyme: 2,3' cyclic phosphate and 5-OH ends are substrates for healing and sealing by Pnkp and Hen1, The 5' end is phosphorylated by the Pnkp kinase and the 2',3' cyclic phosphate is removed by the Pnkp phosphatase ?
-
 ?

Organism

Organism UniProt Comment Textmining
Acetivibrio thermocellus A3DJ38
-
-

Purification (Commentary)

Purification (Comment) Organism
recombinant His-tagged wild-type and mutant enzymes from Escherichia coli strain BL21(DE3) by nickel affinity chromatography Acetivibrio thermocellus

Reaction

Reaction Comment Organism Reaction ID
ATP + 5'-dephospho-DNA = ADP + 5'-phospho-DNA Asp38, as general base, activates the polynucleotide 5'-OH for its nucleophilic attack on the gamma phosphorus and Lys21 and Mg2+ stabilize the transition state, catalytic mechanism, overview Acetivibrio thermocellus
a

Substrates and Products (Substrate)

Substrates Comment Substrates Organism Products Comment (Products) Rev. Reac.
ATP + 5'-dephospho-DNA
-
 Acetivibrio thermocellus ADP + 5'-phospho-DNA
-
 ?
ATP + 5'-dephospho-DNA substrate is a synthetic 36-mer 5'-OH DNA oligonucleotide d(CCTGTTCTTATTGGCCTCCTGGCATACCTTTTCCGG) Acetivibrio thermocellus ADP + 5'-phospho-DNA
-
 ?
additional information Pnkp is a bifunctional enzyme: 2,3' cyclic phosphate and 5-OH ends are substrates for healing and sealing by Pnkp and Hen1, The 5' end is phosphorylated by the Pnkp kinase and the 2',3' cyclic phosphate is removed by the Pnkp phosphatase Acetivibrio thermocellus ?
-
 ?
additional information the alpha and beta phosphates are engaged by a network of hydrogen bonds from Thr23 and the P-loop main-chain amides, the gamma phosphate is anchored by the lid residues Arg120 and Arg123. The P-loop lysine (Lys21) and the catalytic Mg2+ bridge the ATP beta and gamma phosphates Acetivibrio thermocellus ?
-
 ?

Subunits

Subunits Comment Organism
homodimer crystal structure Acetivibrio thermocellus
More the protein consists of a core P-loop phosphotransferase fold embellished by a distinctive homodimerization module composed of secondary structure elements derived from the N and C termini of the kinase domain Acetivibrio thermocellus

Synonyms

Synonyms Comment Organism
5'-OH polynucleotide kinase
-
 Acetivibrio thermocellus
PNKP
-
 Acetivibrio thermocellus

Temperature Optimum [°C]

Temperature Optimum [°C] Temperature Optimum Maximum [°C] Comment Organism
45
-
 assay at Acetivibrio thermocellus

pH Optimum

pH Optimum Minimum pH Optimum Maximum Comment Organism
7
-
 assay at Acetivibrio thermocellus

Cofactor

Cofactor Comment Organism Structure
ATP ATP is bound within a crescent-shaped groove formed by the P-loop (15GSSGSGKST23) and an overlying helix-loop-helix ‘lid Acetivibrio thermocellus

General Information

General Information Comment Organism
metabolism the enzyme is part of the Pnkp-Hen1 RNA repair pathway, overview Acetivibrio thermocellus
additional information structure and mechanism of the polynucleotide kinase component of the bacterial Pnkp-Hen1 RNA repair system, the enzyme has an autonomous kinase domain, overview. Pnkp-Hen1 RNA repair pathway confers protective immunity to recurrent RNA damage Acetivibrio thermocellus