Cloned (Comment) | Organism |
---|---|
expression of His-tagged wild-type and mutant enzymes in Escherichia coli strain BL21(DE3) | Acetivibrio thermocellus |
Crystallization (Comment) | Organism |
---|---|
kinase domain of enzyme Pnkp bound to ATP-Mg2+ or ADP-Mg2+, by hanging drop vapor diffusion, protein solution containing 0.6 mM kinase, 2 mM ATP, and 10 mM MgCl2 with an equal volume of precipitant solution containing 100 mM HEPES, pH 7.5, 200 mM MgCl2, and 30% PEG 400, 22°C, 2 days, X-ray diffraction structure determination and analysis at 2.1 A resolution | Acetivibrio thermocellus |
Protein Variants | Comment | Organism |
---|---|---|
D38E | site-directed mutagenesis, the mutant shows 6% of wild-type activity | Acetivibrio thermocellus |
D38N | site-directed mutagenesis, inactive mutant | Acetivibrio thermocellus |
K21Q | site-directed mutagenesis, the mutant shows 100fold reduced activity compared to the wild-type enzyme | Acetivibrio thermocellus |
K21R | site-directed mutagenesis, the mutant shows 15fold reduced activity compared to the wild-type enzyme | Acetivibrio thermocellus |
K95A | site-directed mutagenesis, inactive mutant, the phenotype is benign | Acetivibrio thermocellus |
R41K | site-directed mutagenesis, the mutant shows about 65% reduced activity compared to the wild-type enzyme | Acetivibrio thermocellus |
R41Q | site-directed mutagenesis, the mutant shows 100fold reduced activity compared to the wild-type enzyme | Acetivibrio thermocellus |
S22T | site-directed mutagenesis, the mutant shows unaltered activity compared to the wild-type enzyme | Acetivibrio thermocellus |
Metals/Ions | Comment | Organism | Structure |
---|---|---|---|
Mg2+ | required, the P-loop lysine (Lys21) and the catalytic Mg2+ bridge the ATP beta and gamma phosphates | Acetivibrio thermocellus |
Natural Substrates | Organism | Comment (Nat. Sub.) | Natural Products | Comment (Nat. Pro.) | Rev. | Reac. |
---|---|---|---|---|---|---|
ATP + 5'-dephospho-DNA | Acetivibrio thermocellus | - |
ADP + 5'-phospho-DNA | - |
? | |
additional information | Acetivibrio thermocellus | Pnkp is a bifunctional enzyme: 2,3' cyclic phosphate and 5-OH ends are substrates for healing and sealing by Pnkp and Hen1, The 5' end is phosphorylated by the Pnkp kinase and the 2',3' cyclic phosphate is removed by the Pnkp phosphatase | ? | - |
? |
Organism | UniProt | Comment | Textmining |
---|---|---|---|
Acetivibrio thermocellus | A3DJ38 | - |
- |
Purification (Comment) | Organism |
---|---|
recombinant His-tagged wild-type and mutant enzymes from Escherichia coli strain BL21(DE3) by nickel affinity chromatography | Acetivibrio thermocellus |
Reaction | Comment | Organism | Reaction ID |
---|---|---|---|
ATP + 5'-dephospho-DNA = ADP + 5'-phospho-DNA | Asp38, as general base, activates the polynucleotide 5'-OH for its nucleophilic attack on the gamma phosphorus and Lys21 and Mg2+ stabilize the transition state, catalytic mechanism, overview | Acetivibrio thermocellus |
Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
---|---|---|---|---|---|---|
ATP + 5'-dephospho-DNA | - |
Acetivibrio thermocellus | ADP + 5'-phospho-DNA | - |
? | |
ATP + 5'-dephospho-DNA | substrate is a synthetic 36-mer 5'-OH DNA oligonucleotide d(CCTGTTCTTATTGGCCTCCTGGCATACCTTTTCCGG) | Acetivibrio thermocellus | ADP + 5'-phospho-DNA | - |
? | |
additional information | Pnkp is a bifunctional enzyme: 2,3' cyclic phosphate and 5-OH ends are substrates for healing and sealing by Pnkp and Hen1, The 5' end is phosphorylated by the Pnkp kinase and the 2',3' cyclic phosphate is removed by the Pnkp phosphatase | Acetivibrio thermocellus | ? | - |
? | |
additional information | the alpha and beta phosphates are engaged by a network of hydrogen bonds from Thr23 and the P-loop main-chain amides, the gamma phosphate is anchored by the lid residues Arg120 and Arg123. The P-loop lysine (Lys21) and the catalytic Mg2+ bridge the ATP beta and gamma phosphates | Acetivibrio thermocellus | ? | - |
? |
Subunits | Comment | Organism |
---|---|---|
homodimer | crystal structure | Acetivibrio thermocellus |
More | the protein consists of a core P-loop phosphotransferase fold embellished by a distinctive homodimerization module composed of secondary structure elements derived from the N and C termini of the kinase domain | Acetivibrio thermocellus |
Synonyms | Comment | Organism |
---|---|---|
5'-OH polynucleotide kinase | - |
Acetivibrio thermocellus |
PNKP | - |
Acetivibrio thermocellus |
Temperature Optimum [°C] | Temperature Optimum Maximum [°C] | Comment | Organism |
---|---|---|---|
45 | - |
assay at | Acetivibrio thermocellus |
pH Optimum Minimum | pH Optimum Maximum | Comment | Organism |
---|---|---|---|
7 | - |
assay at | Acetivibrio thermocellus |
Cofactor | Comment | Organism | Structure |
---|---|---|---|
ATP | ATP is bound within a crescent-shaped groove formed by the P-loop (15GSSGSGKST23) and an overlying helix-loop-helix lid | Acetivibrio thermocellus |
General Information | Comment | Organism |
---|---|---|
metabolism | the enzyme is part of the Pnkp-Hen1 RNA repair pathway, overview | Acetivibrio thermocellus |
additional information | structure and mechanism of the polynucleotide kinase component of the bacterial Pnkp-Hen1 RNA repair system, the enzyme has an autonomous kinase domain, overview. Pnkp-Hen1 RNA repair pathway confers protective immunity to recurrent RNA damage | Acetivibrio thermocellus |