Please wait a moment until all data is loaded. This message will disappear when all data is loaded.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
5'-FAM-pd(CGCTGTCGAACACACGCTTGCGTGTGTTC) + H2O
?
Tequintavirus T5
-
5'-overhanging hairpin substrate
-
-
?
M13mp18 circular ssDNA + H2O
?
-
-
-
-
?
Phi X174 circular ssDNA + H2O
?
-
-
-
-
?
additional information
?
-
DNA + H2O
?
catalyzes the exonucleolytic hydrolysis of blunt ended duplex DNA substrates and the endonucleolytic cleavage of 5-bifurcated nucleic acids at the junction formed between single and doublestranded DNA
products possessing a 5-phosphate and a 3-hydroxyl group
-
?
DNA + H2O
?
DNA substrates without a 3-extrahelical nucleotide and with either no or a shortened 5-flap
products possessing a 5-phosphate and a 3-hydroxyl group
-
?
DNA + H2O
?
the aromatic residues Tyr33 and Phe79, and the aromatic cluster Phe278-Phe279 mainly contribute to the recognition of the substrates without the 3' projection of the upstream strand (the nick, 5'-recess-end, single-flap, and pseudo-Y substrates) for the both exo- and endo-activities, but play minor roles in recognizing the substrates with the 3' projection (the double flap substrate and the nick substrate with the 3' projection)
-
-
?
DNA + H2O
?
the aromatic residues Tyr33 and Phe79, and the aromatic cluster Phe278-Phe279 mainly contribute to the recognition of the substrates without the 3' projection of the upstream strand (the nick, 5'-recess-end, single-flap, and pseudo-Y substrates) for the both exo- and endo-activities, but play minor roles in recognizing the substrates with the 3' projection (the double flap substrate and the nick substrate with the 3' projection)
-
-
?
DNA + H2O
?
Tequintavirus T5
-
catalyzes the exonucleolytic hydrolysis of blunt ended duplex DNA substrates and the endonucleolytic cleavage of 5-bifurcated nucleic acids at the junction formed between single and doublestranded DNA
products possessing a 5-phosphate and a 3-hydroxyl group
-
?
flap DNA + H2O
?
-
-
-
?
flap DNA + H2O
?
Tequintavirus T5
-
-
-
-
?
flap DNA + H2O
?
Tequintavirus T5
-
flap DNA with different sequences and secondary structure used
products possessing a 5-phosphate and a 3-hydroxyl group, length of product depends on the substrate used for the assay
-
?
additional information
?
-
-
other DNA structures tested are found to be poor substrates
-
-
?
additional information
?
-
other DNA structures tested are found to be poor substrates
-
-
?
additional information
?
-
the structure-specific nuclease is involved in DNA replication and repair. In DNA replication the enzyme removes the RNA primer of the lagging strand synthesis. In DNA repair, FEN-1 eliminates the damaged DNA and maintains genome integrity by preventing repeat sequence expansion. It recognizes branched structures containing single unpaired ssDNA (flap). Both the 3'-flap and 5'-flap are recognized by the enzyme and the 5'-flap region is excised. The product is a nicked duplex, which is subsequently sealed by DNA ligase
-
-
?
additional information
?
-
-
a series of substrates of differing sizes is designed to test the effects of the presence or absence of an upstream duplex, a 5'-flap of varying length, and/or a 3'-extrahelical nucleotide but where possible identical sequence, is employed to minimise any effects due to alteration of sequence. Larger DNAs containing two duplex regions are effective substrates for the archaeal enzyme and undergo reaction at multiple sites when they lack a 3'-extrahelical nucleotide. Catalytic parameters of the Archaeoglobus fulgidus enzyme employing flap and double-flap substrates indicate that binding interactions with the 3'-extrahelical nucleotide stabilise the ground state FEN-DNA interaction, leading to stimulation of comparative reactions at DNA concentrations below saturation with the single flap substrate. Maximal multiple turnover rates of the archaeal enzyme with flap and double flap substrates are similar
-
-
?
additional information
?
-
a series of substrates of differing sizes is designed to test the effects of the presence or absence of an upstream duplex, a 5'-flap of varying length, and/or a 3'-extrahelical nucleotide but where possible identical sequence, is employed to minimise any effects due to alteration of sequence. Larger DNAs containing two duplex regions are effective substrates for the archaeal enzyme and undergo reaction at multiple sites when they lack a 3'-extrahelical nucleotide. Catalytic parameters of the Archaeoglobus fulgidus enzyme employing flap and double-flap substrates indicate that binding interactions with the 3'-extrahelical nucleotide stabilise the ground state FEN-DNA interaction, leading to stimulation of comparative reactions at DNA concentrations below saturation with the single flap substrate. Maximal multiple turnover rates of the archaeal enzyme with flap and double flap substrates are similar
-
-
?
additional information
?
-
the archaebacterial FEN-1 binds to flap, pseudo Y, 3' overhang, and nicked DNA structures. It binds weakly to 5' overhangs and shows no apparent affinity toward either single-stranded or duplex DNA
-
-
?
additional information
?
-
-
the structure-specific nuclease that removes 5'-overhanging flaps and the RNA/DNA primer during maturation of the Okazaki fragment
-
-
?
additional information
?
-
the structure-specific nuclease that removes 5'-overhanging flaps and the RNA/DNA primer during maturation of the Okazaki fragment
-
-
?
additional information
?
-
-
FEN1 cleaves substrates bearing telomeric G4 DNA 5'-flaps and is active on substrates bearing telomeric G4 DNA tails, resembling uncapped telomeres, but it is not active on transcribed telomeric G-loops
-
-
?
additional information
?
-
-
FEN1 contacts the DNA primarily with helix and loop elements. Most interactions are to template strand and terminal flap nts. FEN1 with metal ions has a 1828 A2 interface with product DNA, substrate and product binding structures, detailed overview
-
-
?
additional information
?
-
-
Human FEN1 can cleave 5'-flaps bearing structures formed by CTG or CGG repeats, although less efficiently than unstructured flaps. hFEN1 is not affected by the stem-loops formed by CTG repeats interrupting duplex regions adjacent to 5'-flaps, but the enzyme is inhibited by G4 structures formed by CGG repeats in analogous positions. hFEN1 binding causes hypersensitivity near the flap/duplex junction. FEN1 can eliminate structures formed by trinucleotide repeats in the course of replication, relying on endonucleolytic activities
-
-
?
additional information
?
-
-
substrate recognition and binding, orientation of the flaps into nucleosomes is important for the cleavage, patterns, detailed overview. However, flaps within nucleosomes containing the high-affinity 601 DNA sequence are completely resistant to FEN1 cleavage regardless of orientation. Flaps within such high-affinity nucleosome binding sequences will require ATP-dependent remodeling activity for completion of base excision repair
-
-
?
additional information
?
-
-
determination of the FEN1 cleavage site
-
-
?
additional information
?
-
-
FEN1 binding to a flap substrate show that the nuclease binds with similar high affinity to the base of a long flap even when the 5'-end is blocked with biotin/streptavidin. However, FEN1 bound to a blocked flap is more sensitive to sequestration by a competing substrate. FEN1 first binds the flap base and then threads the flap through an opening in the protein from the 5'-end to the base for cleavage, substrate interaction mechanism, overview. Short flaps, below two to four nucleotides long, are cleaved without a threading requirement. Direct flap interactions improve FEN1 binding affinity, dissociation rate is slow when FEN1 is bound to a long, unblocked flap
-
-
?
additional information
?
-
a pseudo-Y-shaped substrate is formed by hybridization of two partially complementary oligonucleotides. FEN cleaves the strand with the free 5' end adjacent to the single-strand-duplex junction. Deletion of the free 3' end prevents cleavage. Hybridization of a complementary oligonucleotide to the free 3' end moves the cleavage site by 1 to 2 nucleotides. Hybridization of excess complementary oligonucleotide to the free 5' end fails to block cleavage
-
-
?
additional information
?
-
-
a pseudo-Y-shaped substrate is formed by hybridization of two partially complementary oligonucleotides. FEN cleaves the strand with the free 5' end adjacent to the single-strand-duplex junction. Deletion of the free 3' end prevents cleavage. Hybridization of a complementary oligonucleotide to the free 3' end moves the cleavage site by 1 to 2 nucleotides. Hybridization of excess complementary oligonucleotide to the free 5' end fails to block cleavage
-
-
?
additional information
?
-
the archaebacterial FEN-1 binds to flap, pseudo Y, 3' overhang, and nicked DNA structures. It binds weakly to 5' overhangs and shows no apparent affinity toward either single-stranded or duplex DNA
-
-
?
additional information
?
-
-
the archaebacterial FEN-1 binds to flap, pseudo Y, 3' overhang, and nicked DNA structures. It binds weakly to 5' overhangs and shows no apparent affinity toward either single-stranded or duplex DNA
-
-
?
additional information
?
-
5'->3' flap endonuclease activity
-
-
?
additional information
?
-
-
5'->3' flap endonuclease activity
-
-
?
additional information
?
-
the archaebacterial FEN-1s bind to flap, pseudo Y, 3' overhang, and nicked DNA structures. It binds weakly to 5' overhangs and shows no apparent affinity toward either single-stranded or duplex DNA
-
-
?
additional information
?
-
-
the archaebacterial FEN-1s bind to flap, pseudo Y, 3' overhang, and nicked DNA structures. It binds weakly to 5' overhangs and shows no apparent affinity toward either single-stranded or duplex DNA
-
-
?
additional information
?
-
the aromatic residues Tyr33 and Phe79, and the aromatic cluster Phe278-Phe279 mainly contribute to the recognition of the substrates without the 3' projection of the upstream strand (the nick, 5'-recess-end, single-flap, and pseudo-Y substrates) for the both exo- and endo-activities, but play minor roles in recognizing the substrates with the 3' projection (the double flap substrate and the nick substrate with the 3' projection)
-
-
?
additional information
?
-
-
the aromatic residues Tyr33 and Phe79, and the aromatic cluster Phe278-Phe279 mainly contribute to the recognition of the substrates without the 3' projection of the upstream strand (the nick, 5'-recess-end, single-flap, and pseudo-Y substrates) for the both exo- and endo-activities, but play minor roles in recognizing the substrates with the 3' projection (the double flap substrate and the nick substrate with the 3' projection)
-
-
?
additional information
?
-
the enzyme cleaves replication fork-like substrates and 5' double-strand flap structures using both flap endonuclease and 5'->3'-exonuclease activities
-
-
?
additional information
?
-
-
the enzyme cleaves replication fork-like substrates and 5' double-strand flap structures using both flap endonuclease and 5'->3'-exonuclease activities
-
-
?
additional information
?
-
FEN-1 has both 5'-flap endonuclease and 5'-3' exonuclease activities, FEN-1 activity is elevated by the presence of a 1 nucleotide expansion at the 3' end in the upstream primer of substrates called: structures with a 1 nt 3'-flap, which appear to be the most preferable substrates for FEN-1. Serial intermediates with a 1 nt 3'-flap and 5' variable-length flaps are formed by cooperative functioning of Pyrococcus horikoshii FEN-1 with either B or D DNA polymerases
-
-
?
additional information
?
-
-
FEN-1 has both 5'-flap endonuclease and 5'-3' exonuclease activities, FEN-1 activity is elevated by the presence of a 1 nucleotide expansion at the 3' end in the upstream primer of substrates called: structures with a 1 nt 3'-flap, which appear to be the most preferable substrates for FEN-1. Serial intermediates with a 1 nt 3'-flap and 5' variable-length flaps are formed by cooperative functioning of Pyrococcus horikoshii FEN-1 with either B or D DNA polymerases
-
-
?
additional information
?
-
the enzyme possesses 5'-flap endonuclease and 5'->3' exonuclease activity
-
-
?
additional information
?
-
-
the enzyme possesses 5'-flap endonuclease and 5'->3' exonuclease activity
-
-
?
additional information
?
-
FEN-1 has both 5'-flap endonuclease and 5'-3' exonuclease activities, FEN-1 activity is elevated by the presence of a 1 nucleotide expansion at the 3' end in the upstream primer of substrates called: structures with a 1 nt 3'-flap, which appear to be the most preferable substrates for FEN-1. Serial intermediates with a 1 nt 3'-flap and 5' variable-length flaps are formed by cooperative functioning of Pyrococcus horikoshii FEN-1 with either B or D DNA polymerases
-
-
?
additional information
?
-
the enzyme possesses 5'-flap endonuclease and 5'->3' exonuclease activity
-
-
?
additional information
?
-
reconstitution of Okazaki fragment maturation in vitro using proteins derived from the archaeon Sulfolobus solfataricus: six proteins are necessary and sufficient for coupled DNA synthesis, RNA primer removal and DNA ligation. PolB1, Fen1 and Lig1 provide the required catalytic activities, with coordination of their activities dependent upon the DNA sliding clamp, proliferating cell nuclear antigen
-
-
?
additional information
?
-
Tequatrovirus T4
phage T4 RNase H shows 5'-3'exonuclease (EC 3.1.13.2) and flap endonuclease (EC 3.1.99.) activities on dsDNA. THe enzyme exhibits also endonucleolytic cleavage to 5'- phosphomonoester, EC 3.1.26.4
-
-
?
additional information
?
-
Tequatrovirus T4
synthetic DNA substrates are used
-
-
?
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Ca2+
Tequintavirus T5
-
at pH 9.3, Ca2+substantially stabilizes both complexes, wild-type-substrate and D201I/D204S-substrate complexes, but calcium ions do not support FEN catalysis and inhibit the reactions supported by viable metal cofactors
K+
monovalent salt effect is broad, with equal activities observed in 50 and 100 mM KCl
KCl
60 mM, the activity increases 1.3-fold, 100 mM KCl result in significant inhibition of activity
Sm3+
-
in the active site, the 5'-monophosphate of the cleaved product nt (-1) is coordinated by two Sm3+ ions. Sm1 is coordinated by Asp86, Glu160, and two oxygens of the cleaved 5'-monophosphate. Sm2 is coordinated by Glu160, Asp179, Asp181 and one phosphate oxygen. Asp34, Glu158, and Asp233 interact with Sm3+ via waters
additional information
Tequintavirus T5
-
M2 is not involved in chemical catalysis but plays a role in substrate binding, and thus a two-metal ion mechanism is plausible. Metallonucleases are often assigned a two-metal ion mechanism where both metals contact the scissile phosphate diester, modeling of the reaction requiring the presence of two ions that are bound independently, overview
Mg2+
endonucleolytic cleavage of flap substrate is only supported by Mg2+ and Mn2+, the cleavage site preferences for each enzyme is altered in the presence of Mn2+
Mg2+
-
two Sm3+ ions occupy Mg2+ ion sites seen in the FEN1 DNA-free structure
Mg2+
addition of magnesium is required for enzyme activity. Mg2+ can not be replaced by Ca2+, Mn2+, or Zn2+. The Mg2+ concentration dependence is weak, with an optimum of 2.5 mM and at least 50% activity between 1 and 10 mM
Mg2+
endonucleolytic cleavage of flap substrate is only supported by Mg2+ and Mn2+, the cleavage site preferences for each enzyme is altered in the presence of Mn2+
Mg2+
endonucleolytic cleavage of flap substrate is only supported by Mg2+ and Mn2+, the cleavage site preferences for each enzyme is altered in the presence of Mn2+
Mg2+
addition of 1 mM MgCl2 increases the activity 1.4-fold. 10 mM MgCl2 results in greater than 90% inhibition
Mg2+
enzyme form StolL-FEN-1 exhibits activity in the concentration range 0.5-10 mM
Mg2+
Tequintavirus T5
-
the overall reaction catalyzed by wild-type T5FEN requires three Mg2+ ions, binding kinetics and mechanism, overview
Mn2+
endonucleolytic cleavage of flap substrate is only supported by Mg2+ and Mn2+, the cleavage site preferences for each enzyme is altered in the presence of Mn2+
Mn2+
endonucleolytic cleavage of flap substrate is only supported by Mg2+ and Mn2+, the cleavage site preferences for each enzyme is altered in the presence of Mn2+
Mn2+
endonucleolytic cleavage of flap substrate is only supported by Mg2+ and Mn2+, the cleavage site preferences for each enzyme is altered in the presence of Mn2+
Mn2+
addition of 0.1 mM MgCl2 increases the activity 1.5-fold. 10 mM MnCl2 results in greater than 90% inhibition
Mn2+
Tequintavirus T5
-
can substitute for Mg2+, binding kinetics and mechanism, overview
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Acquired Immunodeficiency Syndrome
A conserved tyrosine residue aids ternary complex formation, but not catalysis, in phage T5 flap endonuclease.
Adenomatous Polyposis Coli
Adenomatous polyposis coli interacts with flap endonuclease 1 to block its nuclear entry and function.
Adenomatous Polyposis Coli
Interaction between APC and Fen1 during breast carcinogenesis.
Ataxia Telangiectasia
Is there a role for base excision repair in estrogen/estrogen receptor-driven breast cancers?
Bloom Syndrome
Stimulation of flap endonuclease-1 by the Bloom's syndrome protein.
Bloom Syndrome
The interaction site of Flap Endonuclease-1 with WRN helicase suggests a coordination of WRN and PCNA.
Breast Neoplasms
Artichoke Polyphenols Sensitize Human Breast Cancer Cells to Chemotherapeutic Drugs via a ROS-Mediated Downregulation of Flap Endonuclease 1.
Breast Neoplasms
Curcumin increases breast cancer cell sensitivity to cisplatin by decreasing FEN1 expression.
Breast Neoplasms
Curcumin inhibits proliferation of breast cancer cells through Nrf2-mediated down-regulation of Fen1 expression.
Breast Neoplasms
FEN1 gene variants confer reduced risk of breast cancer in chinese women: A case-control study.
Breast Neoplasms
FEN1 is a prognostic biomarker for ER+ breast cancer and associated with tamoxifen resistance through the ER?/cyclin D1/Rb axis.
Breast Neoplasms
Identification of Flap Endonuclease 1 With Diagnostic and Prognostic Value in Breast Cancer.
Breast Neoplasms
Interaction between APC and Fen1 during breast carcinogenesis.
Breast Neoplasms
Is there a role for base excision repair in estrogen/estrogen receptor-driven breast cancers?
Breast Neoplasms
Letrozole improves the sensitivity of breast cancer cells overexpressing aromatase to cisplatin via down-regulation of FEN1.
Breast Neoplasms
Targeting DNA Flap Endonuclease 1 to Impede Breast Cancer Progression.
Breast Neoplasms
The interaction effects of FEN1 rs174538 polymorphism and polycyclic aromatic hydrocarbon exposure on damage in exon 19 and 21 of EGFR gene in coke oven workers.
Carcinogenesis
Association between FEN1 Polymorphisms -69G>A and 4150G>T with Susceptibility in Human Disease: A Meta-Analysis.
Carcinogenesis
Association between the flap endonuclease 1 gene polymorphisms and cancer susceptibility: An updated meta-analysis.
Carcinogenesis
Flap endonuclease 1 polymorphisms (rs174538 and rs4246215) contribute to an increased cancer risk: Evidence from a meta-analysis.
Carcinogenesis
Functional FEN1 genetic variants contribute to risk of hepatocellular carcinoma, esophageal cancer, gastric cancer and colorectal cancer.
Carcinogenesis
Functional FEN1 polymorphisms are associated with DNA damage levels and lung cancer risk.
Carcinogenesis
The Association of Flap Endonuclease 1 Genotypes with the Risk of Childhood Leukemia.
Carcinoma
Flap endonuclease-1 rs174538 G>A polymorphisms are associated with the risk of esophageal cancer in a Chinese population.
Carcinoma, Ductal
The prognostic significance of Flap Endonuclease 1 (FEN1) in breast ductal carcinoma in situ.
Carcinoma, Hepatocellular
Identification of Flap endonuclease 1 as a potential core gene in hepatocellular carcinoma by integrated bioinformatics analysis.
Carcinoma, Hepatocellular
TGF?1- miR-140-5p axis mediated up-regulation of Flap Endonuclease 1 promotes epithelial-mesenchymal transition in hepatocellular carcinoma.
Carcinoma, Intraductal, Noninfiltrating
The prognostic significance of Flap Endonuclease 1 (FEN1) in breast ductal carcinoma in situ.
Cockayne Syndrome
Repair of persistent strand breaks in the mitochondrial genome.
Colonic Neoplasms
Discovery of Myricetin as a Potent Inhibitor of Human Flap Endonuclease 1, Which Potentially Can Be Used as Sensitizing Agent against HT-29 Human Colon Cancer Cells.
Colorectal Neoplasms
An evolutionarily conserved synthetic lethal interaction network identifies FEN1 as a broad-spectrum target for anticancer therapeutic development.
Corneal Dystrophies, Hereditary
Polymorphism of the flap endonuclease 1 gene in keratoconus and Fuchs endothelial corneal dystrophy.
Endometriosis
The Association of Flap Endonuclease 1 Genotypes with the Susceptibility of Endometriosis.
Esophageal Neoplasms
Flap endonuclease-1 rs174538 G>A polymorphisms are associated with the risk of esophageal cancer in a Chinese population.
Esophageal Squamous Cell Carcinoma
Flap endonuclease-1 rs174538 G>A polymorphisms are associated with the risk of esophageal cancer in a Chinese population.
Fanconi Anemia
Human Fanconi anemia complementation group a protein stimulates the 5' flap endonuclease activity of FEN1.
Fuchs' Endothelial Dystrophy
Polymorphism of the flap endonuclease 1 gene in keratoconus and Fuchs endothelial corneal dystrophy.
Gallbladder Neoplasms
Variants and haplotypes in Flap endonuclease 1 and risk of gallbladder cancer and gallstones: a population-based study in China.
Gallstones
Variants and haplotypes in Flap endonuclease 1 and risk of gallbladder cancer and gallstones: a population-based study in China.
Hepatitis B
Flap endonuclease 1 is involved in cccDNA formation in the hepatitis B virus.
Hepatitis B
The cooperative complex of Argonaute-2 and microRNA-146a regulates hepatitis B virus replication through flap endonuclease 1.
Hypersensitivity
Complementary roles for exonuclease 1 and Flap endonuclease 1 in maintenance of triplet repeats.
Hypersensitivity
Flap endonuclease overexpression drives genome instability and DNA damage hypersensitivity in a PCNA-dependent manner.
Keratoconus
Polymorphism of the flap endonuclease 1 gene in keratoconus and Fuchs endothelial corneal dystrophy.
Leukemia
The Association of Flap Endonuclease 1 Genotypes with the Risk of Childhood Leukemia.
Lung Neoplasms
FEN1 promotes tumor progression and confers cisplatin resistance in non-small-cell lung cancer.
Lung Neoplasms
Increased expression and no mutation of the Flap endonuclease (FEN1) gene in human lung cancer.
Lung Neoplasms
Lung cancer: progression of heat shock protein 70 in association with flap endonuclease 1 protein.
Lung Neoplasms
Overexpression of Flap Endonuclease 1 Correlates with Enhanced Proliferation and Poor Prognosis of Non-Small-Cell Lung Cancer.
Malaria
Affen, Menschen und Malaria. Affenmalaria - auch für den Menschen gefährlich!
Myotonic Dystrophy
Fen1 does not control somatic hypermutability of the (CTG)(n).(CAG)(n) repeat in a knock-in mouse model for DM1.
Neoplasms
Association between the flap endonuclease 1 gene polymorphisms and cancer susceptibility: An updated meta-analysis.
Neoplasms
Cancer Biomarker-Triggered Disintegrable DNA Nanogels for Intelligent Drug Delivery.
Neoplasms
Chemical-induced cancer incidence and underlying mechanisms in Fen1 mutant mice.
Neoplasms
FEN1 endonuclease as a therapeutic target for human cancers with defects in homologous recombination.
Neoplasms
FEN1 is a prognostic biomarker for ER+ breast cancer and associated with tamoxifen resistance through the ER?/cyclin D1/Rb axis.
Neoplasms
Flap endonuclease 1 (FEN1) as a novel diagnostic and prognostic biomarker for gastric cancer.
Neoplasms
Flap endonuclease 1 polymorphisms (rs174538 and rs4246215) contribute to an increased cancer risk: Evidence from a meta-analysis.
Neoplasms
Flap endonuclease 1: a novel tumour suppresser protein.
Neoplasms
Flap endonuclease overexpression drives genome instability and DNA damage hypersensitivity in a PCNA-dependent manner.
Neoplasms
Flap endonuclease 1 silencing is associated with increasing the cisplatin sensitivity of SGC?7901 gastric cancer cells.
Neoplasms
Fluorometric detection of cancer marker FEN1 based on double-flapped dumbbell DNA nanoprobe functionalized with silver nanoclusters.
Neoplasms
Haploinsufficiency of Flap endonuclease (Fen1) leads to rapid tumor progression.
Neoplasms
Inhibition of AKT sensitizes cancer cells to antineoplastic drugs by down-regulating Flap Endonuclease 1.
Neoplasms
Interacting partners of FEN1 and its role in the development of anticancer therapeutics.
Neoplasms
Is there a role for base excision repair in estrogen/estrogen receptor-driven breast cancers?
Neoplasms
Jianpi-yangwei decoction inhibits DNA damage repair in the drug resistance of gastric cancer by reducing FEN1 expression.
Neoplasms
Lung cancer: progression of heat shock protein 70 in association with flap endonuclease 1 protein.
Neoplasms
MicroRNA-140 impedes DNA repair by targeting FEN1 and enhances chemotherapeutic response in breast cancer.
Neoplasms
Nucleolar localization and dynamic roles of flap endonuclease 1 in ribosomal DNA replication and damage repair.
Neoplasms
Overexpression and hypomethylation of flap endonuclease 1 gene in breast and other cancers.
Neoplasms
Phosphate steering by Flap Endonuclease 1 promotes 5'-flap specificity and incision to prevent genome instability.
Neoplasms
Precision Spherical Nucleic Acids Enable Sensitive FEN1 Imaging and Controllable Drug Delivery for Cancer-Specific Therapy.
Neoplasms
TGF?1- miR-140-5p axis mediated up-regulation of Flap Endonuclease 1 promotes epithelial-mesenchymal transition in hepatocellular carcinoma.
Neoplasms
The Association of Flap Endonuclease 1 Genotypes with the Susceptibility of Endometriosis.
Neoplasms
The FEN1 E359K germline mutation disrupts the FEN1-WRN interaction and FEN1 GEN activity, causing aneuploidy-associated cancers.
Neoplasms
Upregulation of FEN1 Is Associated with the Tumor Progression and Prognosis of Hepatocellular Carcinoma.
Neoplasms
YY1 suppresses FEN1 over-expression and drug resistance in breast cancer.
Neoplasms
[Flap endonuclease-1 and its role in the processes of DNA metabolism in eucaryotic cells]
Ovarian Neoplasms
Genomic and protein expression analysis reveals flap endonuclease 1 (FEN1) as a key biomarker in breast and ovarian cancer.
Prostatic Neoplasms
Flap endonuclease 1 is overexpressed in prostate cancer and is associated with a high Gleason score.
Stomach Neoplasms
Flap endonuclease 1 (FEN1) as a novel diagnostic and prognostic biomarker for gastric cancer.
Stomach Neoplasms
Flap endonuclease 1 is a promising candidate biomarker in gastric cancer and is involved in cell proliferation and apoptosis.
Stomach Neoplasms
Jianpi-yangwei decoction inhibits DNA damage repair in the drug resistance of gastric cancer by reducing FEN1 expression.
Vitelliform Macular Dystrophy
cDNA cloning and characterization of human Delta5-desaturase involved in the biosynthesis of arachidonic acid.
Werner Syndrome
Werner syndrome protein interacts with human flap endonuclease 1 and stimulates its cleavage activity.
Xeroderma Pigmentosum
Control of structure-specific endonucleases to maintain genome stability.
Xeroderma Pigmentosum
FEN1 participates in repair of the 5'-phosphotyrosyl terminus of DNA single-strand breaks.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
D181A
-
construction of a FEN1 mutant DELTA 336 truncated after residue 336 that bears an additional point mutation at residue 181. FEN1 DELTA336 removes only the flexible, protruding PCNA binding motif and encompasses the entire catalytic domain, and the active site D181A mutation severely retards incision. The DNA contains competing base pairing purine-pyrimidine pairs at the DNA junction, but the C-A mismatch favors 1 nt 3' flap formation
F278A
the substitution of the aromatic residues with alanine leads to a large reduction in kcat value, although the mutants retains Km-value similar to that of the wild-type enzyme
F279A
the substitution of the aromatic residues with alanine leads to a large reduction in kcat value, although the mutants retains Km-value similar to that of the wild-type enzyme
K193A
KM-value is 4fold of the wild-type value, kcat is almost the same as for wild-type enzyme
K193E/R194E/K195E
the negatively charged triple mutant shows similar but more magnified effects on both parameters compared with the alanine triple mutant K193A/R194A/K195A
K195A
KM-value is 8fold of the wild-type value, kcat is almost the same as for wild-type enzyme
K199A
km and kcat values of the mutant enzyme differ little from the wild-type values
K243A
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K243E
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K248A
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K249A
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K263A
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K263E
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
K51E/R53E
the double mutant retains 30% of the wild-type kcat/Km value
K87A
the kcat value of the mutant decreased 400fold, whereas the Km value is almost the same as that of wild-type enzyme
K87A/R88A/K89A
the Km-value is 5fold higher, the kcat is 184fold lower than that of the wild-type enzyme
K93A/R94A/R95A
Km-value and kcat-value is increased 17fold and decreased 96fold, respectively, compared with the wild-type values
L47F
Km-value is similat to the value of the wild-type
L47G
Km value of the mutant is increased 20fold
R194A
KM-value is 5fold of the wild-type value, kcat is almost the same as for wild-type enzyme
R40E/R42E
the Km of the mutynt is increased 105fold compared with wild-type. The kcat and kcat/Km values areo decreased 4- and 680fold, respectively
R40G
Km of the mutant increases 7fold, compared with that of the wild-type enzyme
R40Q
Km value of the single mutant enzyme increases 10fold
R42E
Km and kcat/Km values of the mutant are 19fold higher and 25fold lower than the values of wild-type enzyme, respectively
R42G
Km of the mutant increases 7fold, compared with that of the wild-type enzyme
R42Q
KM-value is almost the same as the value for wild-type enzyme
R88A
Km and kcat values of the mutant enzyme do not change markedly, compared with the wild-type values
R89A
Km and kcat values of the mutant enzyme do not change markedly, compared with the wild-type values
Y237A
Km and kcat/Km values of the mutant enzyme do not change markedly compared with the wild-type values
F35L
-
the kcat and Km show no significant decrease compared with that of wild-type
-
F79A
-
for the 5'-recess-end substrate, the kcat value decreases 71fold compared with that of wild-type enzyme. For the nick substrate, the kcat-value decreases 25fold compared with that of wild-type enzyme
-
Y33A
-
the substitution of the aromatic residues with alanine leads to a large reduction in kcat value (333fold decrease in exo-activity against the 5'-recess-end substrate), although the mutants retains Km-value similar to that of the wild-type enzyme. The exo-activity against the nick substrate, the kcat values decreases 53fold compared with that of wild-type enzyme
-
Y33F
-
the kcat value for exo-activity against the 5'-recess-end substrate is about 25% compared to tht kcat value of wild-type enzyme, the Km value changes slightly compared with that of wild-type enzyme
-
C724A
Tequatrovirus T4
site-directed mutagenesis
L242I
Tequatrovirus T4
naturally occuring mutation, the substitution does not affect the structure of RNase H and its role in providing the das-effect remains unclear
V43I
Tequatrovirus T4
naturally occuring mutation, the V43I substitution may lead to disposition of H4 helix, responsible for the interaction with the first base pairs of 5' end of branched DNA. These structural changes may affect unwinding of the first base pairs of gapped or nicked DNA generating a short flap and therefore may stabilize the DNA-enzyme complex
D201I/D204S
Tequintavirus T5
-
site-directed mutagenesis, the overall reaction catalyzed by mutant D201I/D204S required two Mg2+ ions, in contrast to the wild-type enzyme that requires 3 Mg2+. D201I/D204S T5FENs is biphasic with respect to Ca2+ and ultimately dependent on 1/[Ca2+]2
F278A/F279A
the kcat values of the mutant enzyme are decreased about 1020% with the 5'-recess-end substrate and the nick substrate
F278A/F279A
the kcat value of the mutant enzyme with the 5'-recess-end substrate and the the nick substrate is 10-20% of that of wild-type enzyme
F278H/F279H
kcat value decreases 83fold for the 5'-recess-end substrate and 150fold for the nick substrate compared with the wild-type values. 454fold decrease in kcat/Km for the 5'-recess-end substrate, 80fold decrease in kcat/Km for the nick substrate. The Km-value for the endo activity with the double flap substrate is increased 4fold, the kcat/Km-value is decreased 14fold, compared with the wild-type value
F278H/F279H
the Km value for the 5'-recess-end substrate is elevated 5 times compared with the wild-type value whereas for the nick substrate the Km value of F278H/F279H is 60% the wild-type value
F278H/F279H
the Km value for the 5'-recess-end substrate is elevated 5times compared with that of wild-type enzyme, for the nick substrate the Km value is 60% that of wild-type enzyme
F278L/F279L
Km-values are lower than the wild-type values
F278L/F279L
the kcat values of the mutant enzyme are decreased about 1020% with the 5'-recess-end substrate and the nick substrate
F278L/F279L
the kcat value of the mutant enzyme with the 5'-recess-end substrate and the the nick substrate is 10-20% of that of wild-type enzyme
F278L/F279L
the Km value for the 5'-recess-end substrate and the the nick substrate is lower than that of the wild-type enzyme
F278W/F279W
Km-values are lower than the wild-type values
F278W/F279W
the kcat values of the mutant enzyme are decreased about 1020% with the 5'-recess-end substrate and the nick substrate
F278W/F279W
the kcat value of the mutant enzyme with the 5'-recess-end substrate and the the nick substrate is 10-20% of that of wild-type enzyme
F278W/F279W
the Km value for the 5'-recess-end substrate and the the nick substrate is lower than that of the wild-type enzyme
F278Y/F279Y
Km-values are lower than the wild-type values
F278Y/F279Y
the kcat value of F278Y/F279Y is restored to around 70% of that of wil-type enzyme with the 5'-recess-end substrate and the nick substrate
F278Y/F279Y
the kcat value of the mutant enzyme with the 5'-recess-end substrate and the the nick substrate is around 70% of that of wild-type enzyme
F278Y/F279Y
the Km value for the 5'-recess-end substrate and the the nick substrate is lower than that of the wild-type enzyme
F35A
kcat and Km of F35A and F35L show no significant decrease compared with the wild-type values
F35A
the kcat and Km show no significant decrease compared with that of wild-type. For the nick substrate, the kcat value decreases 25fold compared with that of wild-type enzyme
F35L
kcat and Km of F35A and F35L show no significant decrease compared with the wild-type values
F35L
the kcat and Km show no significant decrease compared with that of wild-type
F35Y
the Km values of the mutant enzyme are about 4- and 3fold higher than the values of wild-type enzyme with the nick and 5'-recess-end substrates, respectively
F35Y
mutation causes an 17fold decrease and an 24fold decrease in kcat with the nick and 5'-recess-end substrates, respectively
F79A
for the 5'-recess-end substrate, the kcat value of the mutant enzyme decreases 71fold compared with that of wild-type.For the nick substrate, the kcat value decreases 25fold compared with that of wild-type. 58fold decrease in kcat/Km for the 5'-recess-end substrate, 75fold decrease in kcat/Km for the nick substrate. The Km-value for the endo activity with the double flap substrate is increased 7fold, the kcat/Km-value is decreased 6fold, compared with the wild-type value.For the single flap and pseudo-Y substrates, the kcat of F79A decreases 31- and 37fold, respectively, compared with that of wild-type
F79A
for the 5'-recess-end substrate, the kcat value decreases 71fold compared with that of wild-type enzyme. For the nick substrate, the kcat-value decreases 25fold compared with that of wild-type enzyme
F79H
te kcat value of the mutant for the 5'-recess-end substrate is decreased to about 50% of the wild-type value, and the kcat value of F79H for the nick substrate is seven times lower than that of wild-type enzyme. The Km value of F79H for the 5'-recess-end substrate is 13fold higher than that of wild-type, whereas the Km value of F79H for the nick substrate is about 2 times higher than that of wild-type
F79H
the kcat value of the mutant enzyme for the nick substrate is seven times lower than that of the wild-type enzyme. The Km value of the mutant enzyme for the 5'-recess-end substrate is 13fold higher than that of wild-type enzyme. The Km value of the mutant enzyme for the nick substrate is about 2 times higher than that of the wild-type enzyme
F79L
for the 5'-recess-end substrate, the kcat value of the mutant enzyme is restored to 20% of the wild-type value.For the nick substrate, the kcat value of the mutant enzyme is restored to 20% of that of the wild-type enzyme. The kcat-values for of the single flap and pseudo-Y substrates decrease to 17 and 7% of the wild-type values, respectively. The Km for the single flap and pseudo-Y substrates is varied moderately, but not significantly, compared with that of wild-type enzyme
F79L
for the 5'-recess-end substrate and for the the nick substrate, the kcat value is 20% of the wild-type value value
F79W
the kcat values of the mutant enzyme for the 5'-recess-end substrate and the nick substrate are restored to almost the same level as the wild-type values
F79W
the kcat value for the 5'-recess-end substrate and for the the nick substrate are almost the same as the wild-type values
F79Y
the kcat values of the mutant enzyme for the 5'-recess-end substrate and the nick substrate are restored to almost the same level as the wild-type values. The kcat-value for the single flap and pseudo-Y substrates are restored to almost the same level as the wild-type substrates
F79Y
the kcat value for the 5'-recess-end substrate and for the the nick substrate are almost the same as the wild-type values
K193A/R194A/K195A
kcat/Km-value is decreased 76fold, compared with the value of wild-type enzyme
K193A/R194A/K195A
the Km value of the mutant enzyme increases markedly and the kcat value decreases moderately
R118A/K119A
kcat-value is decreased 111fold, compared with the wild-type value
R118A/K119A
kcat/Km-value is decreased 1851fold, compared with the value of wild-type enzyme
R118A/K119A
KM-value is magnified by 17fold
R40G/R42G
kcat/Km-value is decreased 222fold, compared with the value of wild-type enzyme
R40G/R42G
KM-value is magnified by 6fold
R40G/R42G
Km-value of the mutant enzyme is elevated 26fold compared with that of the wild type
R94A
kcat-value is decreased 200fold compared with the wild-type value
R94A
mutant enzyme shows a 12fold increase in the Km value and a 15fold decrease in the kcat-value compared with the wild-type values
Y33A
kcat decreases 333fold, compared with that of the wild-type enzyme, for exo-activity against the 5'-recess-end substrate. For the exo-activity against the nick substrate, the kcat values decreases 53fold.The kcat of Y33A for the single flap substrate decreases 30fold. The kcat of Y33A for the pseudo-Y substrate decreases 485fold
Y33A
the substitution of the aromatic residues with alanine leads to a large reduction in kcat value (333fold decrease in exo-activity against the 5'-recess-end substrate), although the mutants retains Km-value similar to that of the wild-type enzyme. The exo-activity against the nick substrate, the kcat values decreases 53fold compared with that of wild-type enzyme
Y33F
kcat for exo-activity against the 5'-recess-end substrate is 20-30% of the wild-type value. The kcat values of Y33F for the single flap and pseudo-Y substrates are restored to 38 and 20% of the value of wild-type, respectively
Y33F
the kcat value for exo-activity against the 5'-recess-end substrate is about 25% compared to tht kcat value of wild-type enzyme, the Km value changes slightly compared with that of wild-type enzyme
Y33H
kcat for exo-activity against the 5'-recess-end substrate is 20-30% of the wild-type value
Y33H
the kcat value for exo-activity against the 5'-recess-end substrate is about 25% compared to tht kcat value of wild-type enzyme, the Km value changes slightly compared with that of wild-type enzyme
Y33L
kcat decreases 1180fold, compared with that of the wild-type enzyme, for exo-activity against the 5'-recess-end substrate. For the exo-activity against the nick substrate, the kcat values decreases 134fold. 2353fold decrease in kcat/Km for the 5'-recess-end substrate, 270fold decrease in kcat/Km for the nick substrate. The Km-value for the endo activity with the double flap substrate is increased 4fold, the kcat/Km-value is decreased 5fold, compared with the wild-type value. The kcat of Y33A for the single flap substrate decreases 433fold. The kcat of Y33A for the pseudo-Y substrate decreases 3233fold
Y33L
the muation leads to a large reduction in kcat value (1180fold decrease in exo-activity against the 5'-recess-end substrate) compared to tht kcat value of wild-type enzyme. The exo-activity against the nick substrate, the kcat values decreases 1343fold compared with that of wild-type enzyme
Y33W
kcat for exo-activity against the 5'-recess-end substrate is 20-30% of the wild-type value
Y33W
the kcat value for exo-activity against the 5'-recess-end substrate is about 25% compared to tht kcat value of wild-type enzyme, the Km value changes slightly compared with that of wild-type enzyme
additional information
the aromatic residues Tyr33 and Phe79, and the aromatic cluster Phe278-Phe279 mainly contribute to the recognition of the substrates without the 3' projection of the upstream strand (the nick, 5'-recess-end, single-flap, and pseudo-Y substrates) for the both exo- and endo-activities, but play minor roles in recognizing the substrates with the 3' projection (the double flap substrate and the nick substrate with the 3' projection). The replacement of Tyr33, Phe79, and Phe278-Phe279, with non-charged aromatic residues, but not with aliphatic hydrophobic residues, recovers the kcat values almost fully for the substrates without the 3' projection of the upstream strand, suggesting that the aromatic groups of Tyr33, Phe79, and Phe278-Phe279 might be involved in the catalytic reaction, probably via multiple stacking interactions with nucleotide bases
additional information
-
the aromatic residues Tyr33 and Phe79, and the aromatic cluster Phe278-Phe279 mainly contribute to the recognition of the substrates without the 3' projection of the upstream strand (the nick, 5'-recess-end, single-flap, and pseudo-Y substrates) for the both exo- and endo-activities, but play minor roles in recognizing the substrates with the 3' projection (the double flap substrate and the nick substrate with the 3' projection). The replacement of Tyr33, Phe79, and Phe278-Phe279, with non-charged aromatic residues, but not with aliphatic hydrophobic residues, recovers the kcat values almost fully for the substrates without the 3' projection of the upstream strand, suggesting that the aromatic groups of Tyr33, Phe79, and Phe278-Phe279 might be involved in the catalytic reaction, probably via multiple stacking interactions with nucleotide bases
additional information
-
the aromatic residues Tyr33 and Phe79, and the aromatic cluster Phe278-Phe279 mainly contribute to the recognition of the substrates without the 3' projection of the upstream strand (the nick, 5'-recess-end, single-flap, and pseudo-Y substrates) for the both exo- and endo-activities, but play minor roles in recognizing the substrates with the 3' projection (the double flap substrate and the nick substrate with the 3' projection). The replacement of Tyr33, Phe79, and Phe278-Phe279, with non-charged aromatic residues, but not with aliphatic hydrophobic residues, recovers the kcat values almost fully for the substrates without the 3' projection of the upstream strand, suggesting that the aromatic groups of Tyr33, Phe79, and Phe278-Phe279 might be involved in the catalytic reaction, probably via multiple stacking interactions with nucleotide bases
-
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Please wait a moment until the data is sorted. This message will disappear when the data is sorted.
Williams, R.; Sengerova, B.; Osborne, S.; Syson, K.; Ault, S.; Kilgour, A.; Chapados, B.R.; Tainer, J.A.; Sayers, J.R.; Grasby, J.A.
Comparison of the catalytic parameters and reaction specificities of a phage and an archaeal flap endonuclease
J. Mol. Biol.
371
34-48
2007
Archaeoglobus fulgidus, Archaeoglobus fulgidus (O29975), Tequintavirus T5
brenda
Vallur, A.C.; Maizels, N.
Complementary roles for exonuclease 1 and Flap endonuclease 1 in maintenance of triplet repeats
J. Biol. Chem.
285
28514-28519
2010
Homo sapiens
brenda
Vallur, A.C.; Maizels, N.
Distinct activities of exonuclease 1 and flap endonuclease 1 at telomeric g4 DNA
PLoS ONE
5
e8908
2010
Homo sapiens
brenda
Mase, T.; Kubota, K.; Miyazono, K.; Kawarabayasi, Y.; Tanokura, M.
Structure of flap endonuclease 1 from the hyperthermophilic archaeon Desulfurococcus amylolyticus
Acta Crystallogr. Sect. F
67
209-213
2011
Desulfurococcus amylolyticus, Desulfurococcus amylolyticus (F2Z289)
brenda
Tsutakawa, S.E.; Classen, S.; Chapados, B.R.; Arvai, A.S.; Finger, L.D.; Guenther, G.; Tomlinson, C.G.; Thompson, P.; Sarker, A.H.; Shen, B.; Cooper, P.K.; Grasby, J.A.; Tainer, J.A.
Human flap endonuclease structures, DNA double-base flipping, and a unified understanding of the FEN1 superfamily
Cell
145
198-211
2011
Homo sapiens
brenda
Gloor, J.W.; Balakrishnan, L.; Bambara, R.A.
Flap endonuclease 1 mechanism analysis indicates flap base binding prior to threading
J. Biol. Chem.
285
34922-34931
2010
Homo sapiens
brenda
Jagannathan, I.; Pepenella, S.; Hayes, J.J.
Activity of FEN1 endonuclease on nucleosome substrates is dependent upon DNA sequence but not flap orientation
J. Biol. Chem.
286
17521-17529
2011
Homo sapiens
brenda
Fortini, B.K.; Pokharel, S.; Polaczek, P.; Balakrishnan, L.; Bambara, R.A.; Campbell, J.L.
Characterization of the endonuclease and ATP-dependent flap endo/exonuclease of Dna2
J. Biol. Chem.
286
23763-23770
2011
Homo sapiens
brenda
Tomlinson, C.G.; Syson, K.; Sengerova, B.; Atack, J.M.; Sayers, J.R.; Swanson, L.; Tainer, J.A.; Williams, N.H.; Grasby, J.A.
Neutralizing mutations of carboxylates that bind metal 2 in T5 flap endonuclease result in an enzyme that still requires two metal ions
J. Biol. Chem.
286
30878-30887
2011
Tequintavirus T5
brenda
Dorjsuren, D.; Kim, D.; Maloney, D.J.; Wilson, D.M.; Simeonov, A.
Complementary non-radioactive assays for investigation of human flap endonuclease 1 activity
Nucleic Acids Res.
39
e11
2011
Homo sapiens
brenda
Collins, B.K.; Tomanicek, S.J.; Lyamicheva, N.; Kaiser, M.W.; Mueser, T.C.
A preliminary solubility screen used to improve crystallization trials: crystallization and preliminary X-ray structure determination of Aeropyrum pernix flap endonuclease-1
Acta Crystallogr. Sect. D
60
1674-1678
2004
Aeropyrum pernix
brenda
Mase, T.; Kubota, K.; Miyazono, K.; Kawarabayasi, Y.; Tanokura, M.
Crystallization and preliminary X-ray analysis of flap endonuclease 1 (FEN1) from Desulfurococcus amylolyticus
Acta Crystallogr. Sect. F
65
923-925
2009
Desulfurococcus amylolyticus (F2Z289), Desulfurococcus amylolyticus
brenda
Henneke, G.
In vitro reconstitution of RNA primer removal in Archaea reveals the existence of two pathways
Biochem. J.
447
271-280
2012
Pyrococcus abyssi (Q9V0P9)
brenda
Horie, M.; Fukui, K.; Xie, M.; Kageyama, Y.; Hamada, K.; Sakihama, Y.; Sugimori, K.; Matsumoto, K.
The N-terminal region is important for the nuclease activity and thermostability of the flap endonuclease-1 from Sulfolobus tokodaii
Biosci. Biotechnol. Biochem.
71
855-865
2007
Sulfurisphaera tokodaii (Q976H6), Sulfurisphaera tokodaii, Sulfurisphaera tokodaii 7 (Q976H6)
brenda
Chapados, B.R.; Hosfield, D.J.; Han, S.; Qiu, J.; Yelent, B.; Shen, B.; Tainer, J.A.
Structural basis for FEN-1 substrate specificity and PCNA-mediated activation in DNA replication and repair
Cell
116
39-50
2004
Archaeoglobus fulgidus (O29975)
brenda
Hosfield, D.J.; Mol, C.D.; Shen, B.; Tainer, J.A.
Structure of the DNA repair and replication endonuclease and exonuclease FEN-1: coupling DNA and PCNA binding to FEN-1 activity
Cell
95
135-146
1998
Pyrococcus furiosus (O93634), Pyrococcus furiosus
brenda
Beattie, T.R.; Bell, S.D.
Coordination of multiple enzyme activities by a single PCNA in archaeal Okazaki fragment maturation
EMBO J.
31
1556-1567
2012
Saccharolobus solfataricus (Q980U8)
brenda
Rao, H.G.; Rosenfeld, A.; Wetmur, J.G.
Methanococcus jannaschii flap endonuclease: expression, purification, and substrate requirements
J. Bacteriol.
180
5406-5412
1998
Methanocaldococcus jannaschii (Q58839), Methanocaldococcus jannaschii
brenda
Hosfield, D.J.; Frank, G.; Weng, Y.; Tainer, J.A.; Shen, B.
Newly discovered archaebacterial flap endonucleases show a structure-specific mechanism for DNA substrate binding and catalysis resembling human flap endonuclease-1
J. Biol. Chem.
273
27154-27161
1998
Archaeoglobus fulgidus (O29975), Methanocaldococcus jannaschii (Q58839), Methanocaldococcus jannaschii, Pyrococcus furiosus (O93634), Pyrococcus furiosus
brenda
Matsui, E.; Kawasaki, S.; Ishida, H.; Ishikawa, K.; Kosugi, Y.; Kikuchi, H.; Kawarabayashi, Y.; Matsui, I.
Thermostable flap endonuclease from the archaeon, Pyrococcus horikoshii, cleaves the replication fork-like structure endo/exonucleolytically
J. Biol. Chem.
274
18297-18309
1999
Pyrococcus horikoshii (O50123), Pyrococcus horikoshii
brenda
Matsui, E.; Musti, K.V.; Abe, J.; Yamasaki, K.; Matsui, I.; Harata, K.
Molecular structure and novel DNA binding sites located in loops of flap endonuclease-1 from Pyrococcus horikoshii
J. Biol. Chem.
277
37840-37847
2002
Pyrococcus horikoshii (O50123), Pyrococcus horikoshii
brenda
Matsui, E.; Abe, J.; Yokoyama, H.; Matsui, I.
Aromatic residues located close to the active center are essential for the catalytic reaction of flap endonuclease-1 from hyperthermophilic archaeon Pyrococcus horikoshii
J. Biol. Chem.
279
16687-16696
2004
Pyrococcus horikoshii (O50123), Pyrococcus horikoshii
brenda
Bae, K.W.; Baek, K.W.; Cho, C.S.; Hwang, K.Y.; Kim, H.-R.; Sung, H.-C.; Cho, Y.
Expression, purification, characterization and crystallization of flap endonuclease-1 from Methanococcus jannaschii
Mol. Cells
9
45-48
1999
Methanocaldococcus jannaschii (Q58839), Methanocaldococcus jannaschii
brenda
Hwang, K.Y.; Baek, K.; Kim, H.-Y.; Cho, Y.
The crystal structure of flap endonuclease-1 from Methanococcus jannaschii
Nat. Struct. Biol.
5
707-713
1998
Methanocaldococcus jannaschii (Q58839), Methanocaldococcus jannaschii
brenda
Dor, A.S.; Kilkenny, M.L.; Jones, S.A.; Oliver, A.W.; Roe, S.M.; Bell, S.D.; Pearl, L.H.
Structure of an archaeal PCNA1-PCNA2-FEN1 complex: elucidating PCNA subunit and client enzyme specificity
Nucleic Acids Res.
34
4515-4526
2006
Archaeoglobus fulgidus (O29975)
brenda
Matsui, E.; Urushibata, Y.; Abe, J.; Matsui, I.
Serial intermediates with a 1 nt 3'-flap and 5' variable-length flaps are formed by cooperative functioning of Pyrococcus horikoshii FEN-1 with either B or D DNA polymerases
Extremophiles
18
415-427
2014
Pyrococcus horikoshii (O50123), Pyrococcus horikoshii, Pyrococcus horikoshii OT-3 (O50123)
brenda
Matsui, E.; Abe, J.; Yokoyama, H.; Matsui, I.
Aromatic residues located close to the active center are essential for the catalytic reaction of flap endonuclease-1 from hyperthermophilic archaeon Pyrococcus horikoshii
J. Biol. Chem.
279
16687-16696
2004
Pyrococcus horikoshii (O50123), Pyrococcus horikoshii, Pyrococcus horikoshii OT-3 (O50123)
brenda
Sgrignani, J.; Magistrato, A.
QM/MM MD simulations on the enzymatic pathway of the human flap endonuclease (hFEN1) elucidating common cleavage pathways to RNase H enzymes
ACS Catal.
5
3864-3875
2015
Homo sapiens (P39748)
-
brenda
Kholod, N.; Sivogrivov, D.; Latypov, O.; Mayorov, S.; Kuznitsyn, R.; Kajava, A.V.; Shlyapnikov, M.; Granovsky, I.
Single substitution in bacteriophage T4 RNase H alters the ratio between its exo- and endonuclease activities
Mutat. Res.
781
49-57
2015
Tequatrovirus T4 (P13319)
brenda