Any feedback?
Literature summary for 2.2.1.6 extracted from
- Development of ssDNA aptamers as potent inhibitors of Mycobacterium tuberculosis acetohydroxyacid synthase (2015), Biochim. Biophys. Acta, 1854, 1338-1350 .
Cloned(Commentary)
| Cloned (Comment) | Organism |
|---|---|
| expressed in Escherichia coli BL21(DE3) cells | Mycobacterium tuberculosis |
Inhibitors
| Inhibitors | Comment | Organism | Structure |
|---|---|---|---|
| additional information | single stranded DNA aptamers Apt1 (CGAGTGAGGGCGAGGCGCGCTCCTGCCGGT) and Apt6 (CGGCCAGGGGACGAGCGCGCCCTGATCGTG) demonstrate the greatest inhibitory potential against the enzyme activity with IC50 values in the low nanomolar range (28.94 and 22.35 nM respectively). Aptamers Apt2, Apt3 and Apt4 show moderate to lower inhibition specificities | Mycobacterium tuberculosis |
Metals/Ions
| Metals/Ions | Comment | Organism | Structure |
|---|---|---|---|
| Mg2+ | 10 mM used in assay conditions | Mycobacterium tuberculosis |  |
Natural Substrates/ Products (Substrates)
| Natural Substrates | Organism | Comment (Nat. Sub.) | Natural Products | Comment (Nat. Pro.) | Rev. | Reac. |
|---|---|---|---|---|---|---|
| 2 pyruvate | Mycobacterium tuberculosis | - |
2-acetolactate + CO2 | - |
? | |
| 2 pyruvate | Mycobacterium tuberculosis H37Rv | - |
2-acetolactate + CO2 | - |
? | |
Organism
| Organism | UniProt | Comment | Textmining |
|---|---|---|---|
| Mycobacterium tuberculosis | - |
- |
- |
| Mycobacterium tuberculosis H37Rv | - |
- |
- |
Purification (Commentary)
| Purification (Comment) | Organism |
|---|---|
- |
Mycobacterium tuberculosis |
Substrates and Products (Substrate)
| Substrates | Comment Substrates | Organism | Products | Comment (Products) | Rev. | Reac. |
|---|---|---|---|---|---|---|
| 2 pyruvate | - |
Mycobacterium tuberculosis | 2-acetolactate + CO2 | - |
? | |
| 2 pyruvate | - |
Mycobacterium tuberculosis H37Rv | 2-acetolactate + CO2 | - |
? | |
Subunits
| Subunits | Comment | Organism |
|---|---|---|
| ? | x * 68000, SDS-PAGE | Mycobacterium tuberculosis |
Synonyms
| Synonyms | Comment | Organism |
|---|---|---|
| acetohydroxyacid synthase | - |
Mycobacterium tuberculosis |
| AHAS | - |
Mycobacterium tuberculosis |
Cofactor
| Cofactor | Comment | Organism | Structure |
|---|---|---|---|
| thiamine diphosphate | - |
Mycobacterium tuberculosis | |
Use of this online version of BRENDA is free under the CC BY 4.0 license. See terms of use for full details.
Release 2023.1 (January 2023)
Legal
Curated at
Member of
